Hello, I have a bunch of perl scripts located in /Users/richsark/scripts
Is there a way I can excute a perl file or even a .sh file from whereve directory I am in?
so if I am in /Users/richsark/anywhere/file/location
I can put in a few letters of my perl script name then hit tab to auto-complete the rest and run it?
Thanks
I am assuming you have made your scripts executable. You can execute such scripts from anywhere by including the prefix path "./". You can even put "." in your path if you want.
Hi there. Yes they are all excutable
You mentioned put "." in my path .... I think I need that... do I vi /etc/profile?
if so I have this..
PATH="$PATH:/opt/local/bin:/opt/local/sbin:/Users/richsark_air/scripts"
PERL_LWP_SSL_VERIFY_HOSTNAME=0
So your saying my path line need to look like..
PATH="$PATH:/opt/local/bin:/opt/local/sbin:/Users/richsark_air/scripts/:.:
For starters you need to put "/Users/richsark/scripts" in your PATH, or have you done that already?
Hi, you mean
vi /etc/profile?
if so I have this now...
PATH="$PATH:/opt/local/bin:/opt/local/sbin:/Users/richsark_air/scripts"
PERL_LWP_SSL_VERIFY_HOSTNAME=0
What is the difference between richsark and richsark_air?
Yes, and I thought that was all that was needed.....
I made a number of simple test cases in several different directories and that's all I needed to get it to expand and run a script.
steve ~ >Hello.pl
Hello World!
steve ~ >example4-1.pl
ACGGGAGGACGGGAAAATTACTACGGCATTAGC
When it expands it include the '.pl' without that it doesn't run.
But some examples I tries, expands but not the .pl, and I get an error when i add the extension
steve ~ >drawrna.pl
-bash: /Users/steve/Mac Programming/Genomic Perl/appa/drawrna.pl: /usr/bin/perl^M: bad interpreter: No such file or directory
These are are sample code for texts and I suspect part of the problem may be the "how do you terminate a text line" issues.
But for the moment it I'm a bit puzzled
What are you seeing when you try it.
Does it expand at all?
If so what happens when you try and run it?
richsark wrote:
Hello, I have a bunch of perl scripts located in /Users/richsark/scripts
Is there a way I can excute a perl file or even a .sh file from whereve directory I am in?
so if I am in /Users/richsark/anywhere/file/location
I can put in a few letters of my perl script name then hit tab to auto-complete the rest and run it?
Thanks
Ok. To summarize.
Your PATH must contain both the location of your scripts, and the notion of current working directory (.)
My perl scripts start with a line like this:
#!/usr/bin/env perl
That way, if you investigate perlbrew in google, you will appreciate this syntax.
I put everything in my .bashrc file and the only thing in my .bash_profile is a check for .bashrc as shown below. I do not use a .profile.
.bashrc
# let me execute anything from my current working directory, or designated scripts directory
# additional necessary paths as needed. You may use ~ instead of $HOME.
export PATH=.:$HOME/scripts:$PATH
.bash_profile
# if file exists and > 0
[[ -s $HOME/.bashrc ]] && source $HOME/.bashrc
$ source .bashrc
$ chmod +x myscript.pl myscript.sh
$ cd ~/Downloads
$ ./myscript.pl
is there a way to run my perl scripts from any location?
